ID: 925833362

View in Genome Browser
Species Human (GRCh38)
Location 2:7918171-7918193
Sequence GGTTGGTCTGTAGGACAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925833362_925833375 23 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833375 2:7918217-7918239 GCACAAGGGTATGAATGACTGGG No data
925833362_925833372 8 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833372 2:7918202-7918224 GTGTGGGAAGGGACAGCACAAGG No data
925833362_925833374 22 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833374 2:7918216-7918238 AGCACAAGGGTATGAATGACTGG No data
925833362_925833365 -9 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833365 2:7918185-7918207 AGACCAACCCTGGTACAGTGTGG No data
925833362_925833369 -3 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833369 2:7918191-7918213 ACCCTGGTACAGTGTGGGAAGGG No data
925833362_925833368 -4 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833368 2:7918190-7918212 AACCCTGGTACAGTGTGGGAAGG No data
925833362_925833378 29 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833378 2:7918223-7918245 GGGTATGAATGACTGGGATGGGG No data
925833362_925833366 -8 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833366 2:7918186-7918208 GACCAACCCTGGTACAGTGTGGG No data
925833362_925833377 28 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833377 2:7918222-7918244 AGGGTATGAATGACTGGGATGGG No data
925833362_925833376 27 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833376 2:7918221-7918243 AAGGGTATGAATGACTGGGATGG No data
925833362_925833373 9 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833373 2:7918203-7918225 TGTGGGAAGGGACAGCACAAGGG No data
925833362_925833379 30 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833379 2:7918224-7918246 GGTATGAATGACTGGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925833362 Original CRISPR GGTTGGTCTGTAGGACAAAG AGG (reversed) Intergenic
No off target data available for this crispr