ID: 925833363

View in Genome Browser
Species Human (GRCh38)
Location 2:7918175-7918197
Sequence TTTGTCCTACAGACCAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925833359_925833363 24 Left 925833359 2:7918128-7918150 CCTTTCACATCTAATCTTGTAAC No data
Right 925833363 2:7918175-7918197 TTTGTCCTACAGACCAACCCTGG No data
925833360_925833363 -2 Left 925833360 2:7918154-7918176 CCATCAGCTCTCCATGTCCTCTT No data
Right 925833363 2:7918175-7918197 TTTGTCCTACAGACCAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925833363 Original CRISPR TTTGTCCTACAGACCAACCC TGG Intergenic
No off target data available for this crispr