ID: 925833368

View in Genome Browser
Species Human (GRCh38)
Location 2:7918190-7918212
Sequence AACCCTGGTACAGTGTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925833360_925833368 13 Left 925833360 2:7918154-7918176 CCATCAGCTCTCCATGTCCTCTT No data
Right 925833368 2:7918190-7918212 AACCCTGGTACAGTGTGGGAAGG No data
925833361_925833368 2 Left 925833361 2:7918165-7918187 CCATGTCCTCTTTGTCCTACAGA No data
Right 925833368 2:7918190-7918212 AACCCTGGTACAGTGTGGGAAGG No data
925833362_925833368 -4 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833368 2:7918190-7918212 AACCCTGGTACAGTGTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925833368 Original CRISPR AACCCTGGTACAGTGTGGGA AGG Intergenic
No off target data available for this crispr