ID: 925833372

View in Genome Browser
Species Human (GRCh38)
Location 2:7918202-7918224
Sequence GTGTGGGAAGGGACAGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925833361_925833372 14 Left 925833361 2:7918165-7918187 CCATGTCCTCTTTGTCCTACAGA No data
Right 925833372 2:7918202-7918224 GTGTGGGAAGGGACAGCACAAGG No data
925833364_925833372 -1 Left 925833364 2:7918180-7918202 CCTACAGACCAACCCTGGTACAG No data
Right 925833372 2:7918202-7918224 GTGTGGGAAGGGACAGCACAAGG No data
925833360_925833372 25 Left 925833360 2:7918154-7918176 CCATCAGCTCTCCATGTCCTCTT No data
Right 925833372 2:7918202-7918224 GTGTGGGAAGGGACAGCACAAGG No data
925833362_925833372 8 Left 925833362 2:7918171-7918193 CCTCTTTGTCCTACAGACCAACC No data
Right 925833372 2:7918202-7918224 GTGTGGGAAGGGACAGCACAAGG No data
925833367_925833372 -9 Left 925833367 2:7918188-7918210 CCAACCCTGGTACAGTGTGGGAA No data
Right 925833372 2:7918202-7918224 GTGTGGGAAGGGACAGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925833372 Original CRISPR GTGTGGGAAGGGACAGCACA AGG Intergenic
No off target data available for this crispr