ID: 925838067

View in Genome Browser
Species Human (GRCh38)
Location 2:7965162-7965184
Sequence TAAGGAAAAATCATTTTACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838067_925838073 17 Left 925838067 2:7965162-7965184 CCCCGTAAAATGATTTTTCCTTA No data
Right 925838073 2:7965202-7965224 ACTTACTTCCCCCAACTGTAGGG No data
925838067_925838072 16 Left 925838067 2:7965162-7965184 CCCCGTAAAATGATTTTTCCTTA No data
Right 925838072 2:7965201-7965223 TACTTACTTCCCCCAACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838067 Original CRISPR TAAGGAAAAATCATTTTACG GGG (reversed) Intergenic
No off target data available for this crispr