ID: 925838069

View in Genome Browser
Species Human (GRCh38)
Location 2:7965164-7965186
Sequence GGTAAGGAAAAATCATTTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838069_925838072 14 Left 925838069 2:7965164-7965186 CCGTAAAATGATTTTTCCTTACC No data
Right 925838072 2:7965201-7965223 TACTTACTTCCCCCAACTGTAGG No data
925838069_925838073 15 Left 925838069 2:7965164-7965186 CCGTAAAATGATTTTTCCTTACC No data
Right 925838073 2:7965202-7965224 ACTTACTTCCCCCAACTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838069 Original CRISPR GGTAAGGAAAAATCATTTTA CGG (reversed) Intergenic
No off target data available for this crispr