ID: 925838070

View in Genome Browser
Species Human (GRCh38)
Location 2:7965180-7965202
Sequence TATCAGACGTGTGTGCGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838070_925838080 29 Left 925838070 2:7965180-7965202 CCTTACCGCACACACGTCTGATA No data
Right 925838080 2:7965232-7965254 TCAGCTGAGCCTGGCAGGAACGG No data
925838070_925838072 -2 Left 925838070 2:7965180-7965202 CCTTACCGCACACACGTCTGATA No data
Right 925838072 2:7965201-7965223 TACTTACTTCCCCCAACTGTAGG No data
925838070_925838079 24 Left 925838070 2:7965180-7965202 CCTTACCGCACACACGTCTGATA No data
Right 925838079 2:7965227-7965249 AAACTTCAGCTGAGCCTGGCAGG No data
925838070_925838073 -1 Left 925838070 2:7965180-7965202 CCTTACCGCACACACGTCTGATA No data
Right 925838073 2:7965202-7965224 ACTTACTTCCCCCAACTGTAGGG No data
925838070_925838078 20 Left 925838070 2:7965180-7965202 CCTTACCGCACACACGTCTGATA No data
Right 925838078 2:7965223-7965245 GGCAAAACTTCAGCTGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838070 Original CRISPR TATCAGACGTGTGTGCGGTA AGG (reversed) Intergenic
No off target data available for this crispr