ID: 925838071

View in Genome Browser
Species Human (GRCh38)
Location 2:7965185-7965207
Sequence GTAAGTATCAGACGTGTGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838071_925838073 -6 Left 925838071 2:7965185-7965207 CCGCACACACGTCTGATACTTAC No data
Right 925838073 2:7965202-7965224 ACTTACTTCCCCCAACTGTAGGG No data
925838071_925838072 -7 Left 925838071 2:7965185-7965207 CCGCACACACGTCTGATACTTAC No data
Right 925838072 2:7965201-7965223 TACTTACTTCCCCCAACTGTAGG No data
925838071_925838083 29 Left 925838071 2:7965185-7965207 CCGCACACACGTCTGATACTTAC No data
Right 925838083 2:7965237-7965259 TGAGCCTGGCAGGAACGGTGGGG No data
925838071_925838078 15 Left 925838071 2:7965185-7965207 CCGCACACACGTCTGATACTTAC No data
Right 925838078 2:7965223-7965245 GGCAAAACTTCAGCTGAGCCTGG No data
925838071_925838080 24 Left 925838071 2:7965185-7965207 CCGCACACACGTCTGATACTTAC No data
Right 925838080 2:7965232-7965254 TCAGCTGAGCCTGGCAGGAACGG No data
925838071_925838082 28 Left 925838071 2:7965185-7965207 CCGCACACACGTCTGATACTTAC No data
Right 925838082 2:7965236-7965258 CTGAGCCTGGCAGGAACGGTGGG No data
925838071_925838079 19 Left 925838071 2:7965185-7965207 CCGCACACACGTCTGATACTTAC No data
Right 925838079 2:7965227-7965249 AAACTTCAGCTGAGCCTGGCAGG No data
925838071_925838081 27 Left 925838071 2:7965185-7965207 CCGCACACACGTCTGATACTTAC No data
Right 925838081 2:7965235-7965257 GCTGAGCCTGGCAGGAACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838071 Original CRISPR GTAAGTATCAGACGTGTGTG CGG (reversed) Intergenic
No off target data available for this crispr