ID: 925838072

View in Genome Browser
Species Human (GRCh38)
Location 2:7965201-7965223
Sequence TACTTACTTCCCCCAACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838070_925838072 -2 Left 925838070 2:7965180-7965202 CCTTACCGCACACACGTCTGATA No data
Right 925838072 2:7965201-7965223 TACTTACTTCCCCCAACTGTAGG No data
925838071_925838072 -7 Left 925838071 2:7965185-7965207 CCGCACACACGTCTGATACTTAC No data
Right 925838072 2:7965201-7965223 TACTTACTTCCCCCAACTGTAGG No data
925838068_925838072 15 Left 925838068 2:7965163-7965185 CCCGTAAAATGATTTTTCCTTAC No data
Right 925838072 2:7965201-7965223 TACTTACTTCCCCCAACTGTAGG No data
925838067_925838072 16 Left 925838067 2:7965162-7965184 CCCCGTAAAATGATTTTTCCTTA No data
Right 925838072 2:7965201-7965223 TACTTACTTCCCCCAACTGTAGG No data
925838069_925838072 14 Left 925838069 2:7965164-7965186 CCGTAAAATGATTTTTCCTTACC No data
Right 925838072 2:7965201-7965223 TACTTACTTCCCCCAACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838072 Original CRISPR TACTTACTTCCCCCAACTGT AGG Intergenic
No off target data available for this crispr