ID: 925838077

View in Genome Browser
Species Human (GRCh38)
Location 2:7965213-7965235
Sequence CTGAAGTTTTGCCCTACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838077_925838079 -9 Left 925838077 2:7965213-7965235 CCAACTGTAGGGCAAAACTTCAG No data
Right 925838079 2:7965227-7965249 AAACTTCAGCTGAGCCTGGCAGG No data
925838077_925838081 -1 Left 925838077 2:7965213-7965235 CCAACTGTAGGGCAAAACTTCAG No data
Right 925838081 2:7965235-7965257 GCTGAGCCTGGCAGGAACGGTGG No data
925838077_925838085 5 Left 925838077 2:7965213-7965235 CCAACTGTAGGGCAAAACTTCAG No data
Right 925838085 2:7965241-7965263 CCTGGCAGGAACGGTGGGGCAGG No data
925838077_925838080 -4 Left 925838077 2:7965213-7965235 CCAACTGTAGGGCAAAACTTCAG No data
Right 925838080 2:7965232-7965254 TCAGCTGAGCCTGGCAGGAACGG No data
925838077_925838083 1 Left 925838077 2:7965213-7965235 CCAACTGTAGGGCAAAACTTCAG No data
Right 925838083 2:7965237-7965259 TGAGCCTGGCAGGAACGGTGGGG No data
925838077_925838086 12 Left 925838077 2:7965213-7965235 CCAACTGTAGGGCAAAACTTCAG No data
Right 925838086 2:7965248-7965270 GGAACGGTGGGGCAGGCAGAAGG No data
925838077_925838082 0 Left 925838077 2:7965213-7965235 CCAACTGTAGGGCAAAACTTCAG No data
Right 925838082 2:7965236-7965258 CTGAGCCTGGCAGGAACGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838077 Original CRISPR CTGAAGTTTTGCCCTACAGT TGG (reversed) Intergenic
No off target data available for this crispr