ID: 925838078

View in Genome Browser
Species Human (GRCh38)
Location 2:7965223-7965245
Sequence GGCAAAACTTCAGCTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838071_925838078 15 Left 925838071 2:7965185-7965207 CCGCACACACGTCTGATACTTAC No data
Right 925838078 2:7965223-7965245 GGCAAAACTTCAGCTGAGCCTGG No data
925838070_925838078 20 Left 925838070 2:7965180-7965202 CCTTACCGCACACACGTCTGATA No data
Right 925838078 2:7965223-7965245 GGCAAAACTTCAGCTGAGCCTGG No data
925838074_925838078 -10 Left 925838074 2:7965210-7965232 CCCCCAACTGTAGGGCAAAACTT No data
Right 925838078 2:7965223-7965245 GGCAAAACTTCAGCTGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838078 Original CRISPR GGCAAAACTTCAGCTGAGCC TGG Intergenic
No off target data available for this crispr