ID: 925838080

View in Genome Browser
Species Human (GRCh38)
Location 2:7965232-7965254
Sequence TCAGCTGAGCCTGGCAGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838071_925838080 24 Left 925838071 2:7965185-7965207 CCGCACACACGTCTGATACTTAC No data
Right 925838080 2:7965232-7965254 TCAGCTGAGCCTGGCAGGAACGG No data
925838077_925838080 -4 Left 925838077 2:7965213-7965235 CCAACTGTAGGGCAAAACTTCAG No data
Right 925838080 2:7965232-7965254 TCAGCTGAGCCTGGCAGGAACGG No data
925838076_925838080 -3 Left 925838076 2:7965212-7965234 CCCAACTGTAGGGCAAAACTTCA No data
Right 925838080 2:7965232-7965254 TCAGCTGAGCCTGGCAGGAACGG No data
925838075_925838080 -2 Left 925838075 2:7965211-7965233 CCCCAACTGTAGGGCAAAACTTC No data
Right 925838080 2:7965232-7965254 TCAGCTGAGCCTGGCAGGAACGG No data
925838070_925838080 29 Left 925838070 2:7965180-7965202 CCTTACCGCACACACGTCTGATA No data
Right 925838080 2:7965232-7965254 TCAGCTGAGCCTGGCAGGAACGG No data
925838074_925838080 -1 Left 925838074 2:7965210-7965232 CCCCCAACTGTAGGGCAAAACTT No data
Right 925838080 2:7965232-7965254 TCAGCTGAGCCTGGCAGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838080 Original CRISPR TCAGCTGAGCCTGGCAGGAA CGG Intergenic
No off target data available for this crispr