ID: 925838082

View in Genome Browser
Species Human (GRCh38)
Location 2:7965236-7965258
Sequence CTGAGCCTGGCAGGAACGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838076_925838082 1 Left 925838076 2:7965212-7965234 CCCAACTGTAGGGCAAAACTTCA No data
Right 925838082 2:7965236-7965258 CTGAGCCTGGCAGGAACGGTGGG No data
925838071_925838082 28 Left 925838071 2:7965185-7965207 CCGCACACACGTCTGATACTTAC No data
Right 925838082 2:7965236-7965258 CTGAGCCTGGCAGGAACGGTGGG No data
925838075_925838082 2 Left 925838075 2:7965211-7965233 CCCCAACTGTAGGGCAAAACTTC No data
Right 925838082 2:7965236-7965258 CTGAGCCTGGCAGGAACGGTGGG No data
925838077_925838082 0 Left 925838077 2:7965213-7965235 CCAACTGTAGGGCAAAACTTCAG No data
Right 925838082 2:7965236-7965258 CTGAGCCTGGCAGGAACGGTGGG No data
925838074_925838082 3 Left 925838074 2:7965210-7965232 CCCCCAACTGTAGGGCAAAACTT No data
Right 925838082 2:7965236-7965258 CTGAGCCTGGCAGGAACGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838082 Original CRISPR CTGAGCCTGGCAGGAACGGT GGG Intergenic
No off target data available for this crispr