ID: 925838083

View in Genome Browser
Species Human (GRCh38)
Location 2:7965237-7965259
Sequence TGAGCCTGGCAGGAACGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838074_925838083 4 Left 925838074 2:7965210-7965232 CCCCCAACTGTAGGGCAAAACTT No data
Right 925838083 2:7965237-7965259 TGAGCCTGGCAGGAACGGTGGGG No data
925838077_925838083 1 Left 925838077 2:7965213-7965235 CCAACTGTAGGGCAAAACTTCAG No data
Right 925838083 2:7965237-7965259 TGAGCCTGGCAGGAACGGTGGGG No data
925838071_925838083 29 Left 925838071 2:7965185-7965207 CCGCACACACGTCTGATACTTAC No data
Right 925838083 2:7965237-7965259 TGAGCCTGGCAGGAACGGTGGGG No data
925838075_925838083 3 Left 925838075 2:7965211-7965233 CCCCAACTGTAGGGCAAAACTTC No data
Right 925838083 2:7965237-7965259 TGAGCCTGGCAGGAACGGTGGGG No data
925838076_925838083 2 Left 925838076 2:7965212-7965234 CCCAACTGTAGGGCAAAACTTCA No data
Right 925838083 2:7965237-7965259 TGAGCCTGGCAGGAACGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838083 Original CRISPR TGAGCCTGGCAGGAACGGTG GGG Intergenic
No off target data available for this crispr