ID: 925838212

View in Genome Browser
Species Human (GRCh38)
Location 2:7966086-7966108
Sequence CAGTGTGAGCTCAAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838212_925838223 25 Left 925838212 2:7966086-7966108 CCAACCTCCTTGAGCTCACACTG No data
Right 925838223 2:7966134-7966156 GCCTTAGCCCACTTTGCACAAGG No data
925838212_925838216 3 Left 925838212 2:7966086-7966108 CCAACCTCCTTGAGCTCACACTG No data
Right 925838216 2:7966112-7966134 GCACCCTGCTGCACACCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838212 Original CRISPR CAGTGTGAGCTCAAGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr