ID: 925838263

View in Genome Browser
Species Human (GRCh38)
Location 2:7966411-7966433
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838257_925838263 28 Left 925838257 2:7966360-7966382 CCTTAAGAACTATTGAACTCACA No data
Right 925838263 2:7966411-7966433 AATTGTCCCAAAAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr