ID: 925838263 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:7966411-7966433 |
| Sequence | AATTGTCCCAAAAGGGAAGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 925838257_925838263 | 28 | Left | 925838257 | 2:7966360-7966382 | CCTTAAGAACTATTGAACTCACA | No data | ||
| Right | 925838263 | 2:7966411-7966433 | AATTGTCCCAAAAGGGAAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 925838263 | Original CRISPR | AATTGTCCCAAAAGGGAAGG AGG | Intergenic | ||
| No off target data available for this crispr | |||||