ID: 925838297

View in Genome Browser
Species Human (GRCh38)
Location 2:7966609-7966631
Sequence GGTCCACAGGACCAGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838287_925838297 9 Left 925838287 2:7966577-7966599 CCAGAACATCCTCTTGGAGATGC No data
Right 925838297 2:7966609-7966631 GGTCCACAGGACCAGGGAGATGG No data
925838290_925838297 0 Left 925838290 2:7966586-7966608 CCTCTTGGAGATGCCGGGCTGAG No data
Right 925838297 2:7966609-7966631 GGTCCACAGGACCAGGGAGATGG No data
925838285_925838297 13 Left 925838285 2:7966573-7966595 CCTCCCAGAACATCCTCTTGGAG No data
Right 925838297 2:7966609-7966631 GGTCCACAGGACCAGGGAGATGG No data
925838286_925838297 10 Left 925838286 2:7966576-7966598 CCCAGAACATCCTCTTGGAGATG No data
Right 925838297 2:7966609-7966631 GGTCCACAGGACCAGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838297 Original CRISPR GGTCCACAGGACCAGGGAGA TGG Intergenic
No off target data available for this crispr