ID: 925838315

View in Genome Browser
Species Human (GRCh38)
Location 2:7966684-7966706
Sequence GGTCCACAGGACCAGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838300_925838315 19 Left 925838300 2:7966642-7966664 CCTCATCCTCCCAGAACATCCTC No data
Right 925838315 2:7966684-7966706 GGTCCACAGGACCAGGGAGATGG No data
925838304_925838315 10 Left 925838304 2:7966651-7966673 CCCAGAACATCCTCTTGGAGGTG No data
Right 925838315 2:7966684-7966706 GGTCCACAGGACCAGGGAGATGG No data
925838302_925838315 13 Left 925838302 2:7966648-7966670 CCTCCCAGAACATCCTCTTGGAG No data
Right 925838315 2:7966684-7966706 GGTCCACAGGACCAGGGAGATGG No data
925838305_925838315 9 Left 925838305 2:7966652-7966674 CCAGAACATCCTCTTGGAGGTGC No data
Right 925838315 2:7966684-7966706 GGTCCACAGGACCAGGGAGATGG No data
925838308_925838315 0 Left 925838308 2:7966661-7966683 CCTCTTGGAGGTGCCGGGCTGAG No data
Right 925838315 2:7966684-7966706 GGTCCACAGGACCAGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838315 Original CRISPR GGTCCACAGGACCAGGGAGA TGG Intergenic
No off target data available for this crispr