ID: 925838783

View in Genome Browser
Species Human (GRCh38)
Location 2:7970989-7971011
Sequence GGACTGAGAGGACCACAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925838773_925838783 30 Left 925838773 2:7970936-7970958 CCCTGTGAATGAAGCAGACACAA No data
Right 925838783 2:7970989-7971011 GGACTGAGAGGACCACAGGGTGG No data
925838774_925838783 29 Left 925838774 2:7970937-7970959 CCTGTGAATGAAGCAGACACAAG No data
Right 925838783 2:7970989-7971011 GGACTGAGAGGACCACAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925838783 Original CRISPR GGACTGAGAGGACCACAGGG TGG Intergenic
No off target data available for this crispr