ID: 925841351

View in Genome Browser
Species Human (GRCh38)
Location 2:7995106-7995128
Sequence GTGCAGAACATGATTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925841350_925841351 17 Left 925841350 2:7995066-7995088 CCTAACTGCAGTTGAATAAACAA No data
Right 925841351 2:7995106-7995128 GTGCAGAACATGATTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925841351 Original CRISPR GTGCAGAACATGATTGAGCC AGG Intergenic
No off target data available for this crispr