ID: 925841782

View in Genome Browser
Species Human (GRCh38)
Location 2:7998832-7998854
Sequence CACTGTATCATCACCTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925841782_925841788 22 Left 925841782 2:7998832-7998854 CCTTTGTAGGTGATGATACAGTG No data
Right 925841788 2:7998877-7998899 TTTGTAAAGAGCAGAGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925841782 Original CRISPR CACTGTATCATCACCTACAA AGG (reversed) Intergenic