ID: 925841885

View in Genome Browser
Species Human (GRCh38)
Location 2:7999769-7999791
Sequence ATTGTCACCAGCAAGGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925841885_925841891 29 Left 925841885 2:7999769-7999791 CCACTGGCCTTGCTGGTGACAAT No data
Right 925841891 2:7999821-7999843 AGCTTGTCACAGATAGAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925841885 Original CRISPR ATTGTCACCAGCAAGGCCAG TGG (reversed) Intergenic
No off target data available for this crispr