ID: 925841886

View in Genome Browser
Species Human (GRCh38)
Location 2:7999776-7999798
Sequence CATCTTCATTGTCACCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925841886_925841891 22 Left 925841886 2:7999776-7999798 CCTTGCTGGTGACAATGAAGATG No data
Right 925841891 2:7999821-7999843 AGCTTGTCACAGATAGAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925841886 Original CRISPR CATCTTCATTGTCACCAGCA AGG (reversed) Intergenic
No off target data available for this crispr