ID: 925841887

View in Genome Browser
Species Human (GRCh38)
Location 2:7999801-7999823
Sequence GCTGGTTTGGCACATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925841887_925841891 -3 Left 925841887 2:7999801-7999823 CCCTCTTCATGTGCCAAACCAGC No data
Right 925841891 2:7999821-7999843 AGCTTGTCACAGATAGAGCGTGG No data
925841887_925841893 26 Left 925841887 2:7999801-7999823 CCCTCTTCATGTGCCAAACCAGC No data
Right 925841893 2:7999850-7999872 CCAGCTTCTCCATAGACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925841887 Original CRISPR GCTGGTTTGGCACATGAAGA GGG (reversed) Intergenic
No off target data available for this crispr