ID: 925841888

View in Genome Browser
Species Human (GRCh38)
Location 2:7999802-7999824
Sequence AGCTGGTTTGGCACATGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925841888_925841893 25 Left 925841888 2:7999802-7999824 CCTCTTCATGTGCCAAACCAGCT No data
Right 925841893 2:7999850-7999872 CCAGCTTCTCCATAGACTCCTGG No data
925841888_925841891 -4 Left 925841888 2:7999802-7999824 CCTCTTCATGTGCCAAACCAGCT No data
Right 925841891 2:7999821-7999843 AGCTTGTCACAGATAGAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925841888 Original CRISPR AGCTGGTTTGGCACATGAAG AGG (reversed) Intergenic
No off target data available for this crispr