ID: 925841891

View in Genome Browser
Species Human (GRCh38)
Location 2:7999821-7999843
Sequence AGCTTGTCACAGATAGAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925841887_925841891 -3 Left 925841887 2:7999801-7999823 CCCTCTTCATGTGCCAAACCAGC No data
Right 925841891 2:7999821-7999843 AGCTTGTCACAGATAGAGCGTGG No data
925841886_925841891 22 Left 925841886 2:7999776-7999798 CCTTGCTGGTGACAATGAAGATG No data
Right 925841891 2:7999821-7999843 AGCTTGTCACAGATAGAGCGTGG No data
925841888_925841891 -4 Left 925841888 2:7999802-7999824 CCTCTTCATGTGCCAAACCAGCT No data
Right 925841891 2:7999821-7999843 AGCTTGTCACAGATAGAGCGTGG No data
925841885_925841891 29 Left 925841885 2:7999769-7999791 CCACTGGCCTTGCTGGTGACAAT No data
Right 925841891 2:7999821-7999843 AGCTTGTCACAGATAGAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925841891 Original CRISPR AGCTTGTCACAGATAGAGCG TGG Intergenic
No off target data available for this crispr