ID: 925841893

View in Genome Browser
Species Human (GRCh38)
Location 2:7999850-7999872
Sequence CCAGCTTCTCCATAGACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925841887_925841893 26 Left 925841887 2:7999801-7999823 CCCTCTTCATGTGCCAAACCAGC No data
Right 925841893 2:7999850-7999872 CCAGCTTCTCCATAGACTCCTGG No data
925841890_925841893 8 Left 925841890 2:7999819-7999841 CCAGCTTGTCACAGATAGAGCGT No data
Right 925841893 2:7999850-7999872 CCAGCTTCTCCATAGACTCCTGG No data
925841889_925841893 13 Left 925841889 2:7999814-7999836 CCAAACCAGCTTGTCACAGATAG No data
Right 925841893 2:7999850-7999872 CCAGCTTCTCCATAGACTCCTGG No data
925841888_925841893 25 Left 925841888 2:7999802-7999824 CCTCTTCATGTGCCAAACCAGCT No data
Right 925841893 2:7999850-7999872 CCAGCTTCTCCATAGACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925841893 Original CRISPR CCAGCTTCTCCATAGACTCC TGG Intergenic
No off target data available for this crispr