ID: 925843903

View in Genome Browser
Species Human (GRCh38)
Location 2:8018753-8018775
Sequence ATTGAGACACTGCTTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925843898_925843903 -3 Left 925843898 2:8018733-8018755 CCAAAGCGTGCCACCCTGCAATT No data
Right 925843903 2:8018753-8018775 ATTGAGACACTGCTTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925843903 Original CRISPR ATTGAGACACTGCTTGAGGA AGG Intergenic
No off target data available for this crispr