ID: 925845122

View in Genome Browser
Species Human (GRCh38)
Location 2:8027828-8027850
Sequence CAATCTCAGCACGGGAGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925845122_925845128 9 Left 925845122 2:8027828-8027850 CCAGTGCTCCCGTGCTGAGATTG No data
Right 925845128 2:8027860-8027882 CTAGGATTACTCCTGTCCTCTGG No data
925845122_925845130 18 Left 925845122 2:8027828-8027850 CCAGTGCTCCCGTGCTGAGATTG No data
Right 925845130 2:8027869-8027891 CTCCTGTCCTCTGGGTTCCCTGG No data
925845122_925845127 -9 Left 925845122 2:8027828-8027850 CCAGTGCTCCCGTGCTGAGATTG No data
Right 925845127 2:8027842-8027864 CTGAGATTGACGGGAAGTCTAGG No data
925845122_925845132 22 Left 925845122 2:8027828-8027850 CCAGTGCTCCCGTGCTGAGATTG No data
Right 925845132 2:8027873-8027895 TGTCCTCTGGGTTCCCTGGCCGG No data
925845122_925845133 23 Left 925845122 2:8027828-8027850 CCAGTGCTCCCGTGCTGAGATTG No data
Right 925845133 2:8027874-8027896 GTCCTCTGGGTTCCCTGGCCGGG No data
925845122_925845129 10 Left 925845122 2:8027828-8027850 CCAGTGCTCCCGTGCTGAGATTG No data
Right 925845129 2:8027861-8027883 TAGGATTACTCCTGTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925845122 Original CRISPR CAATCTCAGCACGGGAGCAC TGG (reversed) Intergenic
No off target data available for this crispr