ID: 925845127

View in Genome Browser
Species Human (GRCh38)
Location 2:8027842-8027864
Sequence CTGAGATTGACGGGAAGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925845119_925845127 7 Left 925845119 2:8027812-8027834 CCCCACTTGTGGCTCTCCAGTGC No data
Right 925845127 2:8027842-8027864 CTGAGATTGACGGGAAGTCTAGG No data
925845121_925845127 5 Left 925845121 2:8027814-8027836 CCACTTGTGGCTCTCCAGTGCTC No data
Right 925845127 2:8027842-8027864 CTGAGATTGACGGGAAGTCTAGG No data
925845122_925845127 -9 Left 925845122 2:8027828-8027850 CCAGTGCTCCCGTGCTGAGATTG No data
Right 925845127 2:8027842-8027864 CTGAGATTGACGGGAAGTCTAGG No data
925845120_925845127 6 Left 925845120 2:8027813-8027835 CCCACTTGTGGCTCTCCAGTGCT No data
Right 925845127 2:8027842-8027864 CTGAGATTGACGGGAAGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925845127 Original CRISPR CTGAGATTGACGGGAAGTCT AGG Intergenic
No off target data available for this crispr