ID: 925845128

View in Genome Browser
Species Human (GRCh38)
Location 2:8027860-8027882
Sequence CTAGGATTACTCCTGTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925845122_925845128 9 Left 925845122 2:8027828-8027850 CCAGTGCTCCCGTGCTGAGATTG No data
Right 925845128 2:8027860-8027882 CTAGGATTACTCCTGTCCTCTGG No data
925845125_925845128 1 Left 925845125 2:8027836-8027858 CCCGTGCTGAGATTGACGGGAAG No data
Right 925845128 2:8027860-8027882 CTAGGATTACTCCTGTCCTCTGG No data
925845119_925845128 25 Left 925845119 2:8027812-8027834 CCCCACTTGTGGCTCTCCAGTGC No data
Right 925845128 2:8027860-8027882 CTAGGATTACTCCTGTCCTCTGG No data
925845121_925845128 23 Left 925845121 2:8027814-8027836 CCACTTGTGGCTCTCCAGTGCTC No data
Right 925845128 2:8027860-8027882 CTAGGATTACTCCTGTCCTCTGG No data
925845120_925845128 24 Left 925845120 2:8027813-8027835 CCCACTTGTGGCTCTCCAGTGCT No data
Right 925845128 2:8027860-8027882 CTAGGATTACTCCTGTCCTCTGG No data
925845126_925845128 0 Left 925845126 2:8027837-8027859 CCGTGCTGAGATTGACGGGAAGT No data
Right 925845128 2:8027860-8027882 CTAGGATTACTCCTGTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925845128 Original CRISPR CTAGGATTACTCCTGTCCTC TGG Intergenic
No off target data available for this crispr