ID: 925845133

View in Genome Browser
Species Human (GRCh38)
Location 2:8027874-8027896
Sequence GTCCTCTGGGTTCCCTGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925845122_925845133 23 Left 925845122 2:8027828-8027850 CCAGTGCTCCCGTGCTGAGATTG No data
Right 925845133 2:8027874-8027896 GTCCTCTGGGTTCCCTGGCCGGG No data
925845125_925845133 15 Left 925845125 2:8027836-8027858 CCCGTGCTGAGATTGACGGGAAG No data
Right 925845133 2:8027874-8027896 GTCCTCTGGGTTCCCTGGCCGGG No data
925845126_925845133 14 Left 925845126 2:8027837-8027859 CCGTGCTGAGATTGACGGGAAGT No data
Right 925845133 2:8027874-8027896 GTCCTCTGGGTTCCCTGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925845133 Original CRISPR GTCCTCTGGGTTCCCTGGCC GGG Intergenic
No off target data available for this crispr