ID: 925852736

View in Genome Browser
Species Human (GRCh38)
Location 2:8098731-8098753
Sequence GCTCATCTGCAAAGAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925852726_925852736 29 Left 925852726 2:8098679-8098701 CCTCCACATCCTCTTGGCCCACG No data
Right 925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG No data
925852732_925852736 6 Left 925852732 2:8098702-8098724 CCAGGACTCCTGAAATGAGTGTG No data
Right 925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG No data
925852733_925852736 -2 Left 925852733 2:8098710-8098732 CCTGAAATGAGTGTGTGCCAAGC No data
Right 925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG No data
925852731_925852736 11 Left 925852731 2:8098697-8098719 CCACGCCAGGACTCCTGAAATGA No data
Right 925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG No data
925852729_925852736 20 Left 925852729 2:8098688-8098710 CCTCTTGGCCCACGCCAGGACTC No data
Right 925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG No data
925852727_925852736 26 Left 925852727 2:8098682-8098704 CCACATCCTCTTGGCCCACGCCA No data
Right 925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG No data
925852730_925852736 12 Left 925852730 2:8098696-8098718 CCCACGCCAGGACTCCTGAAATG No data
Right 925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925852736 Original CRISPR GCTCATCTGCAAAGAGTGGA TGG Intergenic
No off target data available for this crispr