ID: 925862472

View in Genome Browser
Species Human (GRCh38)
Location 2:8193333-8193355
Sequence GGCCATGTTCTGGAATTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925862472_925862476 24 Left 925862472 2:8193333-8193355 CCACTAAATTCCAGAACATGGCC No data
Right 925862476 2:8193380-8193402 AGCTCTAAAAAATTTTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925862472 Original CRISPR GGCCATGTTCTGGAATTTAG TGG (reversed) Intergenic
No off target data available for this crispr