ID: 925864772

View in Genome Browser
Species Human (GRCh38)
Location 2:8217827-8217849
Sequence TTAAAATAGAAGTGGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925864772_925864780 -3 Left 925864772 2:8217827-8217849 CCCTGCCCCCACTTCTATTTTAA No data
Right 925864780 2:8217847-8217869 TAATGATAGGCATGGACAGAAGG No data
925864772_925864781 1 Left 925864772 2:8217827-8217849 CCCTGCCCCCACTTCTATTTTAA No data
Right 925864781 2:8217851-8217873 GATAGGCATGGACAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925864772 Original CRISPR TTAAAATAGAAGTGGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr