ID: 925864780

View in Genome Browser
Species Human (GRCh38)
Location 2:8217847-8217869
Sequence TAATGATAGGCATGGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925864773_925864780 -4 Left 925864773 2:8217828-8217850 CCTGCCCCCACTTCTATTTTAAT No data
Right 925864780 2:8217847-8217869 TAATGATAGGCATGGACAGAAGG No data
925864775_925864780 -9 Left 925864775 2:8217833-8217855 CCCCACTTCTATTTTAATGATAG No data
Right 925864780 2:8217847-8217869 TAATGATAGGCATGGACAGAAGG No data
925864772_925864780 -3 Left 925864772 2:8217827-8217849 CCCTGCCCCCACTTCTATTTTAA No data
Right 925864780 2:8217847-8217869 TAATGATAGGCATGGACAGAAGG No data
925864768_925864780 6 Left 925864768 2:8217818-8217840 CCCTCCAGCCCCTGCCCCCACTT No data
Right 925864780 2:8217847-8217869 TAATGATAGGCATGGACAGAAGG No data
925864774_925864780 -8 Left 925864774 2:8217832-8217854 CCCCCACTTCTATTTTAATGATA No data
Right 925864780 2:8217847-8217869 TAATGATAGGCATGGACAGAAGG No data
925864769_925864780 5 Left 925864769 2:8217819-8217841 CCTCCAGCCCCTGCCCCCACTTC No data
Right 925864780 2:8217847-8217869 TAATGATAGGCATGGACAGAAGG No data
925864771_925864780 -2 Left 925864771 2:8217826-8217848 CCCCTGCCCCCACTTCTATTTTA No data
Right 925864780 2:8217847-8217869 TAATGATAGGCATGGACAGAAGG No data
925864776_925864780 -10 Left 925864776 2:8217834-8217856 CCCACTTCTATTTTAATGATAGG No data
Right 925864780 2:8217847-8217869 TAATGATAGGCATGGACAGAAGG No data
925864770_925864780 2 Left 925864770 2:8217822-8217844 CCAGCCCCTGCCCCCACTTCTAT No data
Right 925864780 2:8217847-8217869 TAATGATAGGCATGGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925864780 Original CRISPR TAATGATAGGCATGGACAGA AGG Intergenic
No off target data available for this crispr