ID: 925864781

View in Genome Browser
Species Human (GRCh38)
Location 2:8217851-8217873
Sequence GATAGGCATGGACAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925864770_925864781 6 Left 925864770 2:8217822-8217844 CCAGCCCCTGCCCCCACTTCTAT No data
Right 925864781 2:8217851-8217873 GATAGGCATGGACAGAAGGAAGG No data
925864769_925864781 9 Left 925864769 2:8217819-8217841 CCTCCAGCCCCTGCCCCCACTTC No data
Right 925864781 2:8217851-8217873 GATAGGCATGGACAGAAGGAAGG No data
925864774_925864781 -4 Left 925864774 2:8217832-8217854 CCCCCACTTCTATTTTAATGATA No data
Right 925864781 2:8217851-8217873 GATAGGCATGGACAGAAGGAAGG No data
925864776_925864781 -6 Left 925864776 2:8217834-8217856 CCCACTTCTATTTTAATGATAGG No data
Right 925864781 2:8217851-8217873 GATAGGCATGGACAGAAGGAAGG No data
925864778_925864781 -7 Left 925864778 2:8217835-8217857 CCACTTCTATTTTAATGATAGGC No data
Right 925864781 2:8217851-8217873 GATAGGCATGGACAGAAGGAAGG No data
925864768_925864781 10 Left 925864768 2:8217818-8217840 CCCTCCAGCCCCTGCCCCCACTT No data
Right 925864781 2:8217851-8217873 GATAGGCATGGACAGAAGGAAGG No data
925864771_925864781 2 Left 925864771 2:8217826-8217848 CCCCTGCCCCCACTTCTATTTTA No data
Right 925864781 2:8217851-8217873 GATAGGCATGGACAGAAGGAAGG No data
925864773_925864781 0 Left 925864773 2:8217828-8217850 CCTGCCCCCACTTCTATTTTAAT No data
Right 925864781 2:8217851-8217873 GATAGGCATGGACAGAAGGAAGG No data
925864775_925864781 -5 Left 925864775 2:8217833-8217855 CCCCACTTCTATTTTAATGATAG No data
Right 925864781 2:8217851-8217873 GATAGGCATGGACAGAAGGAAGG No data
925864772_925864781 1 Left 925864772 2:8217827-8217849 CCCTGCCCCCACTTCTATTTTAA No data
Right 925864781 2:8217851-8217873 GATAGGCATGGACAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925864781 Original CRISPR GATAGGCATGGACAGAAGGA AGG Intergenic
No off target data available for this crispr