ID: 925865065

View in Genome Browser
Species Human (GRCh38)
Location 2:8220099-8220121
Sequence AGATGAGGAGCTGCACCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925865057_925865065 30 Left 925865057 2:8220046-8220068 CCTCTGGGGGAATCCCGACATCT No data
Right 925865065 2:8220099-8220121 AGATGAGGAGCTGCACCCGCTGG No data
925865059_925865065 17 Left 925865059 2:8220059-8220081 CCCGACATCTCAGAGCAGGAAGG No data
Right 925865065 2:8220099-8220121 AGATGAGGAGCTGCACCCGCTGG No data
925865063_925865065 -7 Left 925865063 2:8220083-8220105 CCTTTAGAGGCTCTGCAGATGAG No data
Right 925865065 2:8220099-8220121 AGATGAGGAGCTGCACCCGCTGG No data
925865061_925865065 16 Left 925865061 2:8220060-8220082 CCGACATCTCAGAGCAGGAAGGT No data
Right 925865065 2:8220099-8220121 AGATGAGGAGCTGCACCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925865065 Original CRISPR AGATGAGGAGCTGCACCCGC TGG Intergenic
No off target data available for this crispr