ID: 925866471

View in Genome Browser
Species Human (GRCh38)
Location 2:8232377-8232399
Sequence ATGCTGGAACTGGTGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925866471_925866477 -2 Left 925866471 2:8232377-8232399 CCCTGTCCCACCAGTTCCAGCAT No data
Right 925866477 2:8232398-8232420 ATCTCCACCACCTTGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925866471 Original CRISPR ATGCTGGAACTGGTGGGACA GGG (reversed) Intergenic
No off target data available for this crispr