ID: 925866713

View in Genome Browser
Species Human (GRCh38)
Location 2:8234545-8234567
Sequence TCAGCTCCACACTGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925866702_925866713 21 Left 925866702 2:8234501-8234523 CCTGCCCCCAGTGCTGTAAGTTC No data
Right 925866713 2:8234545-8234567 TCAGCTCCACACTGAGAGGAAGG No data
925866703_925866713 17 Left 925866703 2:8234505-8234527 CCCCCAGTGCTGTAAGTTCTATG No data
Right 925866713 2:8234545-8234567 TCAGCTCCACACTGAGAGGAAGG No data
925866706_925866713 15 Left 925866706 2:8234507-8234529 CCCAGTGCTGTAAGTTCTATGGA No data
Right 925866713 2:8234545-8234567 TCAGCTCCACACTGAGAGGAAGG No data
925866704_925866713 16 Left 925866704 2:8234506-8234528 CCCCAGTGCTGTAAGTTCTATGG No data
Right 925866713 2:8234545-8234567 TCAGCTCCACACTGAGAGGAAGG No data
925866707_925866713 14 Left 925866707 2:8234508-8234530 CCAGTGCTGTAAGTTCTATGGAA No data
Right 925866713 2:8234545-8234567 TCAGCTCCACACTGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925866713 Original CRISPR TCAGCTCCACACTGAGAGGA AGG Intergenic
No off target data available for this crispr