ID: 925868133

View in Genome Browser
Species Human (GRCh38)
Location 2:8246609-8246631
Sequence GTCTGTGAAGGGCCCTTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925868119_925868133 26 Left 925868119 2:8246560-8246582 CCCCAGCAGGAGGTCCCAGCCCA No data
Right 925868133 2:8246609-8246631 GTCTGTGAAGGGCCCTTCTATGG No data
925868120_925868133 25 Left 925868120 2:8246561-8246583 CCCAGCAGGAGGTCCCAGCCCAC No data
Right 925868133 2:8246609-8246631 GTCTGTGAAGGGCCCTTCTATGG No data
925868121_925868133 24 Left 925868121 2:8246562-8246584 CCAGCAGGAGGTCCCAGCCCACT No data
Right 925868133 2:8246609-8246631 GTCTGTGAAGGGCCCTTCTATGG No data
925868126_925868133 6 Left 925868126 2:8246580-8246602 CCACTGCACTCTGGTCTCCCTCA No data
Right 925868133 2:8246609-8246631 GTCTGTGAAGGGCCCTTCTATGG No data
925868123_925868133 12 Left 925868123 2:8246574-8246596 CCCAGCCCACTGCACTCTGGTCT No data
Right 925868133 2:8246609-8246631 GTCTGTGAAGGGCCCTTCTATGG No data
925868125_925868133 7 Left 925868125 2:8246579-8246601 CCCACTGCACTCTGGTCTCCCTC No data
Right 925868133 2:8246609-8246631 GTCTGTGAAGGGCCCTTCTATGG No data
925868124_925868133 11 Left 925868124 2:8246575-8246597 CCAGCCCACTGCACTCTGGTCTC No data
Right 925868133 2:8246609-8246631 GTCTGTGAAGGGCCCTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925868133 Original CRISPR GTCTGTGAAGGGCCCTTCTA TGG Intergenic
No off target data available for this crispr