ID: 925873628

View in Genome Browser
Species Human (GRCh38)
Location 2:8293095-8293117
Sequence TCTAAGGGCCCTTGTCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925873628_925873635 5 Left 925873628 2:8293095-8293117 CCTGTTTGACAAGGGCCCTTAGA No data
Right 925873635 2:8293123-8293145 AGGGAGAAGAGTTCAAAGCAGGG No data
925873628_925873634 4 Left 925873628 2:8293095-8293117 CCTGTTTGACAAGGGCCCTTAGA No data
Right 925873634 2:8293122-8293144 GAGGGAGAAGAGTTCAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925873628 Original CRISPR TCTAAGGGCCCTTGTCAAAC AGG (reversed) Intergenic
No off target data available for this crispr