ID: 925881354

View in Genome Browser
Species Human (GRCh38)
Location 2:8355404-8355426
Sequence ATCTTGTGTACTTAGTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925881354_925881356 -3 Left 925881354 2:8355404-8355426 CCCAGACACTAAGTACACAAGAT No data
Right 925881356 2:8355424-8355446 GATGTTCATGCACCACAATTAGG No data
925881354_925881358 14 Left 925881354 2:8355404-8355426 CCCAGACACTAAGTACACAAGAT No data
Right 925881358 2:8355441-8355463 ATTAGGATTAAATGAGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925881354 Original CRISPR ATCTTGTGTACTTAGTGTCT GGG (reversed) Intergenic
No off target data available for this crispr