ID: 925881355

View in Genome Browser
Species Human (GRCh38)
Location 2:8355405-8355427
Sequence CATCTTGTGTACTTAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925881355_925881358 13 Left 925881355 2:8355405-8355427 CCAGACACTAAGTACACAAGATG No data
Right 925881358 2:8355441-8355463 ATTAGGATTAAATGAGCATATGG No data
925881355_925881356 -4 Left 925881355 2:8355405-8355427 CCAGACACTAAGTACACAAGATG No data
Right 925881356 2:8355424-8355446 GATGTTCATGCACCACAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925881355 Original CRISPR CATCTTGTGTACTTAGTGTC TGG (reversed) Intergenic
No off target data available for this crispr