ID: 925881356

View in Genome Browser
Species Human (GRCh38)
Location 2:8355424-8355446
Sequence GATGTTCATGCACCACAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925881353_925881356 4 Left 925881353 2:8355397-8355419 CCAGGGACCCAGACACTAAGTAC No data
Right 925881356 2:8355424-8355446 GATGTTCATGCACCACAATTAGG No data
925881355_925881356 -4 Left 925881355 2:8355405-8355427 CCAGACACTAAGTACACAAGATG No data
Right 925881356 2:8355424-8355446 GATGTTCATGCACCACAATTAGG No data
925881352_925881356 7 Left 925881352 2:8355394-8355416 CCTCCAGGGACCCAGACACTAAG No data
Right 925881356 2:8355424-8355446 GATGTTCATGCACCACAATTAGG No data
925881354_925881356 -3 Left 925881354 2:8355404-8355426 CCCAGACACTAAGTACACAAGAT No data
Right 925881356 2:8355424-8355446 GATGTTCATGCACCACAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925881356 Original CRISPR GATGTTCATGCACCACAATT AGG Intergenic
No off target data available for this crispr