ID: 925886044

View in Genome Browser
Species Human (GRCh38)
Location 2:8394432-8394454
Sequence CTGGGCAGGGGGAAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925886044_925886057 17 Left 925886044 2:8394432-8394454 CCCTTCACCTTCCCCCTGCCCAG No data
Right 925886057 2:8394472-8394494 CTCCCTAAGGCTGCTCTCCCAGG No data
925886044_925886055 4 Left 925886044 2:8394432-8394454 CCCTTCACCTTCCCCCTGCCCAG No data
Right 925886055 2:8394459-8394481 TGACACAAAGGACCTCCCTAAGG No data
925886044_925886051 -8 Left 925886044 2:8394432-8394454 CCCTTCACCTTCCCCCTGCCCAG No data
Right 925886051 2:8394447-8394469 CTGCCCAGCACCTGACACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925886044 Original CRISPR CTGGGCAGGGGGAAGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr