ID: 925888121

View in Genome Browser
Species Human (GRCh38)
Location 2:8411082-8411104
Sequence TGGTACGGGAGCCACTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925888121_925888131 10 Left 925888121 2:8411082-8411104 CCAACCCAGTGGCTCCCGTACCA No data
Right 925888131 2:8411115-8411137 ATGGATTTCAGTTCAATTACAGG No data
925888121_925888125 -9 Left 925888121 2:8411082-8411104 CCAACCCAGTGGCTCCCGTACCA No data
Right 925888125 2:8411096-8411118 CCCGTACCACAACTGCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925888121 Original CRISPR TGGTACGGGAGCCACTGGGT TGG (reversed) Intergenic
No off target data available for this crispr