ID: 925889885

View in Genome Browser
Species Human (GRCh38)
Location 2:8425097-8425119
Sequence CACACGAATGGGCCGCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925889879_925889885 6 Left 925889879 2:8425068-8425090 CCACTTAGCTGAGGCCACAGCAA No data
Right 925889885 2:8425097-8425119 CACACGAATGGGCCGCCTGTGGG No data
925889880_925889885 -8 Left 925889880 2:8425082-8425104 CCACAGCAACCTTCTCACACGAA No data
Right 925889885 2:8425097-8425119 CACACGAATGGGCCGCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925889885 Original CRISPR CACACGAATGGGCCGCCTGT GGG Intergenic
No off target data available for this crispr