ID: 925893579

View in Genome Browser
Species Human (GRCh38)
Location 2:8455257-8455279
Sequence GGACTCCGGCGGGCCTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925893579_925893589 27 Left 925893579 2:8455257-8455279 CCAGGGAAGGCCCGCCGGAGTCC No data
Right 925893589 2:8455307-8455329 TCCCTGCAAAGTGTAACCTAAGG No data
925893579_925893584 0 Left 925893579 2:8455257-8455279 CCAGGGAAGGCCCGCCGGAGTCC No data
Right 925893584 2:8455280-8455302 AGCACCCCTTAAAGTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925893579 Original CRISPR GGACTCCGGCGGGCCTTCCC TGG (reversed) Intergenic
No off target data available for this crispr