ID: 925894284

View in Genome Browser
Species Human (GRCh38)
Location 2:8459410-8459432
Sequence CAGGATAAGCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925894284_925894298 25 Left 925894284 2:8459410-8459432 CCCTCTTCCCTCTGCTTATCCTG No data
Right 925894298 2:8459458-8459480 CCCTGTAATCAACATAAGCCAGG No data
925894284_925894292 -3 Left 925894284 2:8459410-8459432 CCCTCTTCCCTCTGCTTATCCTG No data
Right 925894292 2:8459430-8459452 CTGGGGACCACTACCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925894284 Original CRISPR CAGGATAAGCAGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr